Review



qpcr amplification  (Roche)


Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Roche qpcr amplification
    Qpcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/LightCycler+480+System/pmc13080490-133-17-26
    Average 99 stars, based on 6 article reviews
    qpcr amplification - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Exploration of the temporal-spatial expression pattern and DNA methylation-related regulation of the duck telomerase reverse transcriptase gene.
    Article Snippet: Briefly, each qPCR reaction contained 10 μL of ChamQ Universal SYBR qPCR Master Mix (2×) (Vazyme), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 1.0 μL of template cDNA, and 8.0 μL of double-distilled water. .. The qPCR amplification was conducted in a LightCycler 96 Real-Time PCR System (Roche). ..

    Article Title: Effects of dietary histamine on gastrointestinal morphology, antioxidant capacity, and muscle quality in striped catfish ( Pangasianodon hypophthalmus )
    Article Snippet: RNA samples were reverse-transcribed into cDNA using the PrimeScriptTM RT Reagent Kit (Takara, Shiga, Japan) following the manufacturer's protocol. .. For qPCR, gene-specific primers ( ) were designed using Primer 5 software, based on NCBI-annotated reference sequences. qPCR amplification was performed on a LightCycler® 480 System (Roche Diagnostics, Basel, Switzerland) using the SYBR® Premix ExTaqTM II Kit (Takara, Shiga, Japan). ..

    Article Title: Polystyrene nanoplastics exposure trigger cognitive impairment mitigated by luteolin modulated glucose-6-phosphate dehydrogenase/glutathione-dependent pathway.
    Article Snippet: • LUT relieves PSNPs-induced striatal ferroptosis and neuroinflammation.. • PSNPs promote ER Ca2+ homeostasis imbalance via Piezo1/CaN/NFAT1 axis.. • PSNPs cause oxidative stress and mitochondrial dysfunction to trigger

    Article Title: DNA methylation of CA10 regulates the proliferation and metastasis of bladder cancer
    Article Snippet: To generate cDNA, 1 μg of total RNA was reverse transcribed using the TM III First-Strand Synthesis Kit (Invitrogen). .. QPCR amplification was performed on the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) using SYBR Realtime PCR Master Mixers used are listed in Supplemental Table 2 * . ..

    Article Title: Integrating Exosomal MicroRNA and Electronic Health Data Improves Tuberculosis Diagnosis
    Article Snippet: Background Tuberculosis is difficult to diagnose under complex clinical conditions.. Diagnostic information from electronic health records (EHRs) remains insufficient.. Exosomal miRNAs have emerged as promising disease biomarkers.

    Article Title: Comparison of human monocyte derived macrophages and THP1-like macrophages as in vitro models for M. tuberculosis infection.
    Article Snippet: For cDNA preparation 0.5 μg RNA was converted using the Quantitect R Reverse Transcription Kit (QIAGEN, USA). .. To ensure the removal of genomic DNA, ‘gDNA wipe-out buffer’ was added to RNA (included in the kit) prior to the RNA conversion step. qPCR amplification was run on a LightCycler R 96 system (Roche, Germany). ..

    Article Title: Exploration of the temporal-spatial expression pattern and DNA methylation-related regulation of the duck telomerase reverse transcriptase gene.
    Article Snippet: Each reaction contained 10 μL of ChamQ Universal SYBR qPCR Master Mix (2×) (Vazyme), 0.8 μL of primer TS (10 μM), 0.4 μL of primer ACX (10 μM), and was adjusted to 20 μL of total vol- ume with RNase-free water. .. The assay run consisted of 30-min incubation at 30◦C, followed by 10-min incubation at 95◦C and 40 cycles of 95◦C for 10 s, 60◦C for 30 s, then a single cycle of 95◦C for 10 s, 65◦C for 60 s, 97◦C for 1 s. The qPCR amplification was conducted in the LightCycler 96 Real-Time PCR System (Roche). ..

    Amplification:

    Article Title: Exploration of the temporal-spatial expression pattern and DNA methylation-related regulation of the duck telomerase reverse transcriptase gene.
    Article Snippet: Briefly, each qPCR reaction contained 10 μL of ChamQ Universal SYBR qPCR Master Mix (2×) (Vazyme), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 1.0 μL of template cDNA, and 8.0 μL of double-distilled water. .. The qPCR amplification was conducted in a LightCycler 96 Real-Time PCR System (Roche). ..

    Article Title: Effects of dietary histamine on gastrointestinal morphology, antioxidant capacity, and muscle quality in striped catfish ( Pangasianodon hypophthalmus )
    Article Snippet: RNA samples were reverse-transcribed into cDNA using the PrimeScriptTM RT Reagent Kit (Takara, Shiga, Japan) following the manufacturer's protocol. .. For qPCR, gene-specific primers ( ) were designed using Primer 5 software, based on NCBI-annotated reference sequences. qPCR amplification was performed on a LightCycler® 480 System (Roche Diagnostics, Basel, Switzerland) using the SYBR® Premix ExTaqTM II Kit (Takara, Shiga, Japan). ..

    Article Title: Polystyrene nanoplastics exposure trigger cognitive impairment mitigated by luteolin modulated glucose-6-phosphate dehydrogenase/glutathione-dependent pathway.
    Article Snippet: • LUT relieves PSNPs-induced striatal ferroptosis and neuroinflammation.. • PSNPs promote ER Ca2+ homeostasis imbalance via Piezo1/CaN/NFAT1 axis.. • PSNPs cause oxidative stress and mitochondrial dysfunction to trigger

    Article Title: DNA methylation of CA10 regulates the proliferation and metastasis of bladder cancer
    Article Snippet: To generate cDNA, 1 μg of total RNA was reverse transcribed using the TM III First-Strand Synthesis Kit (Invitrogen). .. QPCR amplification was performed on the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) using SYBR Realtime PCR Master Mixers used are listed in Supplemental Table 2 * . ..

    Article Title: Integrating Exosomal MicroRNA and Electronic Health Data Improves Tuberculosis Diagnosis
    Article Snippet: Background Tuberculosis is difficult to diagnose under complex clinical conditions.. Diagnostic information from electronic health records (EHRs) remains insufficient.. Exosomal miRNAs have emerged as promising disease biomarkers.

    Article Title: Comparison of human monocyte derived macrophages and THP1-like macrophages as in vitro models for M. tuberculosis infection.
    Article Snippet: For cDNA preparation 0.5 μg RNA was converted using the Quantitect R Reverse Transcription Kit (QIAGEN, USA). .. To ensure the removal of genomic DNA, ‘gDNA wipe-out buffer’ was added to RNA (included in the kit) prior to the RNA conversion step. qPCR amplification was run on a LightCycler R 96 system (Roche, Germany). ..

    Article Title: Exploration of the temporal-spatial expression pattern and DNA methylation-related regulation of the duck telomerase reverse transcriptase gene.
    Article Snippet: Each reaction contained 10 μL of ChamQ Universal SYBR qPCR Master Mix (2×) (Vazyme), 0.8 μL of primer TS (10 μM), 0.4 μL of primer ACX (10 μM), and was adjusted to 20 μL of total vol- ume with RNase-free water. .. The assay run consisted of 30-min incubation at 30◦C, followed by 10-min incubation at 95◦C and 40 cycles of 95◦C for 10 s, 60◦C for 30 s, then a single cycle of 95◦C for 10 s, 65◦C for 60 s, 97◦C for 1 s. The qPCR amplification was conducted in the LightCycler 96 Real-Time PCR System (Roche). ..

    Software:

    Article Title: Effects of dietary histamine on gastrointestinal morphology, antioxidant capacity, and muscle quality in striped catfish ( Pangasianodon hypophthalmus )
    Article Snippet: RNA samples were reverse-transcribed into cDNA using the PrimeScriptTM RT Reagent Kit (Takara, Shiga, Japan) following the manufacturer's protocol. .. For qPCR, gene-specific primers ( ) were designed using Primer 5 software, based on NCBI-annotated reference sequences. qPCR amplification was performed on a LightCycler® 480 System (Roche Diagnostics, Basel, Switzerland) using the SYBR® Premix ExTaqTM II Kit (Takara, Shiga, Japan). ..

    Reverse Transcription:

    Article Title: Polystyrene nanoplastics exposure trigger cognitive impairment mitigated by luteolin modulated glucose-6-phosphate dehydrogenase/glutathione-dependent pathway.
    Article Snippet: • LUT relieves PSNPs-induced striatal ferroptosis and neuroinflammation.. • PSNPs promote ER Ca2+ homeostasis imbalance via Piezo1/CaN/NFAT1 axis.. • PSNPs cause oxidative stress and mitochondrial dysfunction to trigger

    Polymerase Chain Reaction:

    Article Title: DNA methylation of CA10 regulates the proliferation and metastasis of bladder cancer
    Article Snippet: To generate cDNA, 1 μg of total RNA was reverse transcribed using the TM III First-Strand Synthesis Kit (Invitrogen). .. QPCR amplification was performed on the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) using SYBR Realtime PCR Master Mixers used are listed in Supplemental Table 2 * . ..

    Generated:

    Article Title: Integrating Exosomal MicroRNA and Electronic Health Data Improves Tuberculosis Diagnosis
    Article Snippet: Background Tuberculosis is difficult to diagnose under complex clinical conditions.. Diagnostic information from electronic health records (EHRs) remains insufficient.. Exosomal miRNAs have emerged as promising disease biomarkers.

    Fluorescence:

    Article Title: Integrating Exosomal MicroRNA and Electronic Health Data Improves Tuberculosis Diagnosis
    Article Snippet: Background Tuberculosis is difficult to diagnose under complex clinical conditions.. Diagnostic information from electronic health records (EHRs) remains insufficient.. Exosomal miRNAs have emerged as promising disease biomarkers.

    Incubation:

    Article Title: Exploration of the temporal-spatial expression pattern and DNA methylation-related regulation of the duck telomerase reverse transcriptase gene.
    Article Snippet: Each reaction contained 10 μL of ChamQ Universal SYBR qPCR Master Mix (2×) (Vazyme), 0.8 μL of primer TS (10 μM), 0.4 μL of primer ACX (10 μM), and was adjusted to 20 μL of total vol- ume with RNase-free water. .. The assay run consisted of 30-min incubation at 30◦C, followed by 10-min incubation at 95◦C and 40 cycles of 95◦C for 10 s, 60◦C for 30 s, then a single cycle of 95◦C for 10 s, 65◦C for 60 s, 97◦C for 1 s. The qPCR amplification was conducted in the LightCycler 96 Real-Time PCR System (Roche). ..



    Similar Products

    96
    MedChemExpress cdna amplification
    Cdna Amplification, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/RT+Master+Mix+for+qPCR/pmc13450448-131-10-12
    Average 96 stars, based on 1 article reviews
    cdna amplification - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Roche qpcr amplification
    Qpcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/LightCycler+480+System/pmc13080490-133-17-26
    Average 99 stars, based on 1 article reviews
    qpcr amplification - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    TaKaRa norovirus detection rt qpcr kit for wastewater
    Norovirus Detection Rt Qpcr Kit For Wastewater, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/PCR+Amplification+Kit/pm42008083-78-46-52
    Average 96 stars, based on 1 article reviews
    norovirus detection rt qpcr kit for wastewater - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Vazyme Biotech Co pcr amplification
    Pcr Amplification, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/ChamQ+SYBR+qPCR+Master+Mix+-+Low+ROX+Premixed/pm41981656-85-10-6
    Average 96 stars, based on 1 article reviews
    pcr amplification - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Roche qpcr amplification data
    Qpcr Amplification Data, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/KAPA+Quantification+Kit/pm41957609-95-17-20
    Average 99 stars, based on 1 article reviews
    qpcr amplification data - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    TaKaRa sybr green premix pro taq hs qpcr kit
    Sybr Green Premix Pro Taq Hs Qpcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/PCR+Amplification+Kit/pm41840629-142-7-15
    Average 96 stars, based on 1 article reviews
    sybr green premix pro taq hs qpcr kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Bio-Rad qpcr amplification employing ssoadvanced universal sybr green supermix
    Evaluation of the HHV−1 viral load using real-time PCR (( A <t>)—qPCR</t> <t>amplification</t> curves; ( B )—relative quantification; horizontal line on ( A ) marks the threshold, which is the baseline for Cq (quantification cycle) determination).
    Qpcr Amplification Employing Ssoadvanced Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+amplification/SsoAdvanced+Universal+SYBR+Green+Supermix/pmc12986051-496-1-9
    Average 99 stars, based on 1 article reviews
    qpcr amplification employing ssoadvanced universal sybr green supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Evaluation of the HHV−1 viral load using real-time PCR (( A )—qPCR amplification curves; ( B )—relative quantification; horizontal line on ( A ) marks the threshold, which is the baseline for Cq (quantification cycle) determination).

    Journal: Molecules

    Article Title: Elderberry and Linden Flowers Ethanol–Water Extracts: Extraction Type Effect, Analysis and Biological Activity Determination

    doi: 10.3390/molecules31050764

    Figure Lengend Snippet: Evaluation of the HHV−1 viral load using real-time PCR (( A )—qPCR amplification curves; ( B )—relative quantification; horizontal line on ( A ) marks the threshold, which is the baseline for Cq (quantification cycle) determination).

    Article Snippet: Subsequently, qPCR amplification employing SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Life Science Group, Hercules, CA, USA) and primers (UL54F–5′CGCCAAGAAAATTTCATCGAG 3′, UL54R–5′ ACATCTTGCAC CACGCCAG 3′) on the CFX96 (Bio-Rad Laboratories) thermal cycler was performed.

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Quantitative Proteomics